A4/Liste des articles /3ième

-vidéo OGM:


-Quand la biologie corrige l’histoire:L’ADN révèle les secrets de Toutânkhamon…Science et vie privée?:


Une première mondiale:des cellules à ADN synthétique capables de se répliquer:




Une première mondiale:des cellules à ADN synthétique capables de se répliquer

Annonce faite par John Craig Venter  et son équipe, le 20 mai 2010 dans la revue Science

«We report the design, synthesis, and assembly of the 1.08-Mbp Mycoplasma mycoides JCVI-syn1.0 genome starting from digitized genome sequence information and its transplantation into a Mycoplasma capricolum recipient cell to create new Mycoplasma mycoides cells that are controlled only by the synthetic chromosome. The only DNA in the cells is the designed synthetic DNA sequence, including « watermark » sequences and other designed gene deletions and polymorphisms, and mutations acquired during the building process. The new cells have expected phenotypic properties and are capable of continuous self replication. (Source http://www.sciencemag.org/cgi/content/abstract/science.1190719 ):

«Nous rapportons la conception, la synthèse et l’assemblage de 1,08 Mb du génome Mycoplasma mycoides JCVI-syn 1.0, numérisés à partir des informations sur la séquence du génome et sa transplantation dans un Mycoplasma capricolum, cellule receveuse, pour créer de nouveaux Mycoplasma mycoides, cellules qui sont contrôlées uniquement par le chromosome synthétique. L’ADN présent dans les cellules n’est que de l’ADN conçu par synthèse y compris (…) les polymorphismes et les mutations acquises au cours du processus de construction. Les nouvelles cellules ont les propriétés phénotypiques prévues et sont capables d’autoréplication. »source http://www.slate.fr/story/21757/adn-genome-synthese-john-craig-venter

Mb: méga base=1000000 de bases Cliquer ici pour voir le document

Qui est John Craig Venter ?


Dr. Craig Venter (right) and Michael Janich/User Mjanich on en.wikipedia

C’est le  fondateur de John Craig Venter Institute ( http://www.jcvi.org/ ) ; il  a participé en 2000 au premier séquençage du génome humain…..  en 2007, il a reconstitué le premier ADN de synthèse…  Cliquer ici pour en savoir davantage …

Cette nouvelle est une avancée colossale……

Philippe Marlière( spécialiste de biologie synthétique au Genopole d’Evry) précise :« Pour qui ambitionne de créer des bactéries n’existant pas dans la nature, c’est une avancée aussi importante que l’invention de l’imprimerie par rapport à l’écriture ! »Source ici

Quelques explications :

Les mycoplasmes sont des bactéries .Les mycoplasmes sont aussi remarquables par la petite taille de leurs cellules (de 0,2 à 0,3 micromètres) et de leurs génomes (Ils possèdent  un seul chromosome, certains  ont moins de 1000 gènes.Leur ADN est circulaire ). Ce sont les plus petits organismes connus capables de se multiplier en dehors d’une cellule vivante et donc doués d’une vie indépendante. Au microscope, ils ont un aspect caractéristique « en œuf sur le plat ».

A titre comparatif:

-Chez l’Homme il y a environ 20000 à 25000 gènes; l’ADN est composé de 3,4 milliards de paires de bases…

-Chez les mycoplasmes, il y a moins de 1000 gènes ;l’ ADN de Mycoplasma mycoides a un peu plus d’un million de paires de bases…

Rappel de la structure de l’ADN:

l’ADN  contient  tous les codes indispensables  au  fonctionnement d’une cellule ; « L’alphabet » de l’ADN comprend  quatre bases (les nucléotides) que l’on nomme A, C, T et G, ces bases sont accrochées à la suite les unes des autres  pour former un brin d’ADN.

L’autre brin (car l’ADN est une double hélice) est complémentaire du premier :

A est complémentaire de T, idem entre C et G.

L’ADN en double hélice :


Source de la photo:SVT Ac-Dijon

NB: Les gènes(voir ici)sont des séquences spécifiques  codantes de bases ( donnant des instructions sur la façon de fabriquer  des protéines ). Les gènes ne représentent qu’environ 2% du génome humain, le reste se compose de régions non codantes……

Séquencer un génome, c’est déterminer l’enchainement de ces quatre bases sur toute la longueur du brin (un seul  suffit puisque l’un est le complémentaire  de l’autre) .

On obtient des suites: GGTACCTGTGCAGTGACGTGGTTTTAAGCTGC…Ces séquences sont enregistrées sur des ordinateurs puis  publiées dans des banques de données….

Cliquer ici pour voir une belle animation(lien) décrivant le principe du séquençage (Jussieu – Génoscope).

Quel est le protocole suivi ?

– 1/ L’ADN de Mycoplasma mycoides est séquencé (voir les explications);.. puis créé synthétiquement en laboratoire à partir de ces données numériques.

– 2/ La cellule receveuse Mycoplasma capricolum(espèce différente) est privée de son propre ADN.

– 3/ L’ADN de synthèse est introduit dans cette  cellule receveuse.

Cette nouvelle cellule ( Cliquer ici pour voir la photo ) avec  son  seul ADN de synthèse peut se répliquer  et  donne naissance à d’autres cellules identiques….(Cliquer ici pour voir la photo)….

Les nouvelles cellules produites  de «  Mycoplasma mycoides transformées » sont donc uniquement contrôlées par cet ADN  de synthèse.(cliquer ici pour voir les photos)

Une nouvelle espèce est donc créée.

Cependant, il n’existe pour l’instant aucun cadre légal  face à cette possible création de cellules à ADN de synthèse….

Plusieurs groupes de surveillance éthique (canadien et britannique) ont  réagi.

« Cet organisme synthétique, dont l’ETC Group avait déjà annoncé la création et qu’il avait baptisé « Synthia » il y a trois ans, va susciter de vives controverses sur la pertinence, sur le plan éthique, de créer la vie artificiellement et sur les implications de la biologie synthétique, qui constitue un domaine encore pratiquement inconnu. »…….Voir la suite de l’article http://www.etcgroup.org/en/node/5143

Affaire à suivre…..

Quand la Biologie corrige l’Histoire: L’ADN révèle les secrets de Toutânkhamon

Les techniques les plus modernes de la Recherche nous livrent les secrets de Toutânkhamon…Science et vie privée? …

Qui est Toutânkhamon?

Ce « pharaon d’or  » entre dans l’Histoire le 4 novembre 1922 lorsque l’archéologue britannique Howard Carter découvre sa sépulture(Vallée des rois / Egypte ) et tous ses fabuleux trésors….

Toutânkhamon est né vers -1345 et mort vers -1327 .

Monté sur le trône à 8 ans environ et mort aux alentours de 18 ans, sans descendants, cet « enfant-roi » est le onzième pharaon de la XVIII dynastie (Nouvel Empire),.

carte-vallee-des-roisSource :


sans titre2

plan de la tombe: avec l’autorisation de l’association » LES AMIS DE L’ÉGYPTE ANCIENNE « 

280px-Howard_Carter_1924 Howard Carter en 1924

Source: http://fr.wikipedia.org/wiki/Howard_Carter



Photo taken by Hajor, Dec.2002. Released under cc.by.sa and/or GFDL.



Tombe de Toutânkhamon et masque funéraire/ Source Wikipedia

-quelques trésors….

trône Trône de Toutânkhamon

avec l’autorisation de l’association » LES AMIS DE L’ÉGYPTE ANCIENNE

collier Colliers

avec l’autorisation de l’association » LES AMIS DE L’ÉGYPTE ANCIENNE

Vous pouvez voir de très belles photos sur ce site:


Les historiens et les scientifiques se mettront-ils d’accord?

Les historiens pensaient jusqu’à présent qu’il était le fils d’Akhénaton et de Néfertiti. 

L’ADN révèle les secrets de sa vie:

l’ADN?De quoi s’agit-il?

Voir  le document:


Chaque chromosome est constitué d’ADN.


Sur les chromosomes, on localise de nombreuses portions : les gènes porteurs d’informations génétiques codant pour des caractères (groupes sanguins, couleurs des yeux…).

Une autre forme d’ADN existe: il ne  se trouve pas dans le noyau des cellules ,mais dans des organites du cytoplasme(mitochondries): c’est l’ADN mitochondrial,il est transmis par la mère.

sans titre2

Structure simplifiée d’une cellule


Schéma d’une mitochondrie.

L’étude approfondie de cet ADN , vieux de plus de 3000 ans, nous livre les secrets de sa filiation.

Il est probablement le fils d’Akhénaton et de l’une de ses sœurs :L’inceste était fréquent dans les familles royales d’ Egypte à cette période de l’histoire;Il fallait conserver le sang « pur » de ces pharaons à ascendance divine…

L’arbre généalogique


-D’autres études permettent de préciser les maladies qui l’ont atteint, les conditions de sa mort ….Pour en savoir davantage regardez les documents vidéos ci dessous

Voir l’article sur


Voir les cinq épisodes de la malédiction de Toutânkhamon (France 5):

La Malediction de Toutankhamon (1 sur 5)

La Malediction de Toutankhamon (2 sur 5)

La Malediction de Toutankhamon (3 sur 5)

La Malediction de Toutankhamon (4 sur 5)

La Malediction de Toutankhamon (5 sur 5)


Liste des articles/ troisième /A2 l’information génétique

A2/ L’information génétique:

-le cours:


– des documents:

-vidéo Jeulin:


– animation sur l’ADN:


– vidéo:Qu’est ce qu’un gène?


– l’ADN :structure et réplication:


le site” gènes: ABC”:
