2010:liste des articles

-Développement durable,biodiversité, réchauffement climatique: le sommet de Cancun :

L’ADN révèle les secrets de Toutankhamon

-Biodiversité:la dixième conférence de Nagoya(Japon) :

-Une première mondiale:des cellules à ADN synthétique capables de se répliquer 

-Nouvelle révélation: l’espèce « Australopithecus sediba », hominidé du site de Malapa (Afrique du Sud)…. :

-« L’os fossile de Denisova »… Une nouvelle espèce humaine découverte?

-Les biocarburants, ressources énergétiques durables?

-12/01/2010:après la pauvreté, les ouragans, les inondations …un puissant séisme dévaste Haïti. :

La formule E=mc2…..


Tweet about this on TwitterShare on FacebookShare on Google+Share on LinkedInEmail this to someonePrint this page

Développement durable,biodiversité, réchauffement climatique: le sommet de Cancun

La 16e Conférence de la Convention-cadre des Nations Unies sur les changements climatiques s’est tenue  du 29 novembre au 10 décembre 2010 à Cancún, au Mexique.


Le développement durable n’est possible qu’en sauvegardant la biodiversité et en gérant la durabilité des terres; la perte de biodiversité est liée  aux  changements climatiques..Relever ces  défis est un des objectifs de la Conférence de Cancun….

Un  accord a été  conclu entre 194 pays  pour lutter contre le réchauffement climatique.

Ces mesures comprennent :

 » -la formalisation des promesses de réduction des émissions,

– garantir l »augmentation de la responsabilité de chacun de prendre des mesures concrètes pour protéger les forêts mondiales qui comptent pour près d »un cinquième des émissions globales de carbone,

-établir un fond sur le financement de la lutte contre le changement climatique sur le long terme,

-s »accorder pour combler les différences entre la première et la seconde période du Protocole de Kyoto

-renforcer la coopération technologique

-et favoriser l »adaptation des populations les plus vulnérables au changement climatique »

précise  le secrétaire général de l’ONU Ban Ki-moon.

A cette occasion, le Canada, le Japon et la Russie ont demandé  un nouveau traité incluant les d’ autres pays émetteurs de gaz à effet de serre (notamment les Etats-Unis, la Chine et l’Inde….)

N’oublions pas que le Protocole de Kyoto (  Voir le dossier de l’INA ) arrive à échéance fin 2012 ; il  constitue le seul traité juridiquement contraignant sur le climat pour tous les pays industrialisés (sauf pour les Etats Unis qui ne l’ont pas ratifié)….

La suite à  à Durban fin 2011……

A voir: Le sommet de Cancun, un quizz en dix questions: http://ecologie.blog.lemonde.fr/2010/12/11/quiz-le-sommet-de-cancun-en-dix-questions/

Tweet about this on TwitterShare on FacebookShare on Google+Share on LinkedInEmail this to someonePrint this page

Biodiversité:la dixième conférence de Nagoya(Japon)

La dixième réunion de la Conférence des Parties (Cop 10 http://www.cbd.int/ ) s’est tenue à Nagoya, dans la préfecture d’Aichi, au Japon, du 18 au 29 octobre 2010... des scientifiques et des représentants de 193 nations ont parlé de biodiversité.



« Transmettre une Terre avec une biodiversité riche, aux prochaines générations est le désir partagé partout dans le monde,” a déclaré le ministre de l’Environnement, Ryu Matsumoto.

Ce fait n’est pas nouveau; depuis 1992, ce sujet est d’actualité:

-voir les articles de mon blog  sur les conférences de l’ONU ( le site de l’ONU http://www.un.org/fr )

-voir en particulier l’article https://lewebpedagogique.com/arnaud/conferences-de-lonu/lonu-declare-2010-annee-internationale-de-la-biodiversite/

Notons que Les Américains n’ont pas ratifié la Convention sur la biodiversité  (débutée en 1992 au sommet de Rio et entrée en vigueur en 1993 ). L’accord de Nagoya ne s’applique donc pas aux Etats-Unis et à leurs entreprises…Rappelons nous aussi qu’ils sont les premiers producteurs de dioxyde de carbone….

En synthèse, une fois encore des accords sont pris(voir ici http://www.un.org/apps/newsFr/storyF.asp?NewsID=23517&Cr=biodiversit%E9&Cr1= )….le plus difficile reste à faire …continuer à mettre en pratique et faire vivre les décisions prises pour garantir l’avenir de la Planète.

Tweet about this on TwitterShare on FacebookShare on Google+Share on LinkedInEmail this to someonePrint this page

Une première mondiale:des cellules à ADN synthétique capables de se répliquer

Annonce faite par John Craig Venter  et son équipe, le 20 mai 2010 dans la revue Science

«We report the design, synthesis, and assembly of the 1.08-Mbp Mycoplasma mycoides JCVI-syn1.0 genome starting from digitized genome sequence information and its transplantation into a Mycoplasma capricolum recipient cell to create new Mycoplasma mycoides cells that are controlled only by the synthetic chromosome. The only DNA in the cells is the designed synthetic DNA sequence, including « watermark » sequences and other designed gene deletions and polymorphisms, and mutations acquired during the building process. The new cells have expected phenotypic properties and are capable of continuous self replication. (Source http://www.sciencemag.org/cgi/content/abstract/science.1190719 ):

«Nous rapportons la conception, la synthèse et l’assemblage de 1,08 Mb du génome Mycoplasma mycoides JCVI-syn 1.0, numérisés à partir des informations sur la séquence du génome et sa transplantation dans un Mycoplasma capricolum, cellule receveuse, pour créer de nouveaux Mycoplasma mycoides, cellules qui sont contrôlées uniquement par le chromosome synthétique. L’ADN présent dans les cellules n’est que de l’ADN conçu par synthèse y compris (…) les polymorphismes et les mutations acquises au cours du processus de construction. Les nouvelles cellules ont les propriétés phénotypiques prévues et sont capables d’autoréplication. »source http://www.slate.fr/story/21757/adn-genome-synthese-john-craig-venter

Mb: méga base=1000000 de bases Cliquer ici pour voir le document

Qui est John Craig Venter ?

800px-Venter-janich2

Dr. Craig Venter (right) and Michael Janich/User Mjanich on en.wikipedia

C’est le  fondateur de John Craig Venter Institute ( http://www.jcvi.org/ ) ; il  a participé en 2000 au premier séquençage du génome humain…..  en 2007, il a reconstitué le premier ADN de synthèse…  Cliquer ici pour en savoir davantage …

Cette nouvelle est une avancée colossale……

Philippe Marlière( spécialiste de biologie synthétique au Genopole d’Evry) précise :« Pour qui ambitionne de créer des bactéries n’existant pas dans la nature, c’est une avancée aussi importante que l’invention de l’imprimerie par rapport à l’écriture ! »Source ici


Quelques explications :

Les mycoplasmes sont des bactéries .Les mycoplasmes sont aussi remarquables par la petite taille de leurs cellules (de 0,2 à 0,3 micromètres) et de leurs génomes (Ils possèdent  un seul chromosome, certains  ont moins de 1000 gènes.Leur ADN est circulaire ). Ce sont les plus petits organismes connus capables de se multiplier en dehors d’une cellule vivante et donc doués d’une vie indépendante. Au microscope, ils ont un aspect caractéristique « en œuf sur le plat ».

A titre comparatif:

-Chez l’Homme il y a environ 20000 à 25000 gènes; l’ADN est composé de 3,4 milliards de paires de bases…

-Chez les mycoplasmes, il y a moins de 1000 gènes ;l’ ADN de Mycoplasma mycoides a un peu plus d’un million de paires de bases…

Rappel de la structure de l’ADN:

l’ADN  contient  tous les codes indispensables  au  fonctionnement d’une cellule ; « L’alphabet » de l’ADN comprend  quatre bases (les nucléotides) que l’on nomme A, C, T et G, ces bases sont accrochées à la suite les unes des autres  pour former un brin d’ADN.

L’autre brin (car l’ADN est une double hélice) est complémentaire du premier :

A est complémentaire de T, idem entre C et G.

L’ADN en double hélice :

adn2

Source de la photo:SVT Ac-Dijon

NB: Les gènes(voir ici)sont des séquences spécifiques  codantes de bases ( donnant des instructions sur la façon de fabriquer  des protéines ). Les gènes ne représentent qu’environ 2% du génome humain, le reste se compose de régions non codantes……

Séquencer un génome, c’est déterminer l’enchainement de ces quatre bases sur toute la longueur du brin (un seul  suffit puisque l’un est le complémentaire  de l’autre) .

On obtient des suites: GGTACCTGTGCAGTGACGTGGTTTTAAGCTGC…Ces séquences sont enregistrées sur des ordinateurs puis  publiées dans des banques de données….

Cliquer ici pour voir une belle animation(lien) décrivant le principe du séquençage (Jussieu – Génoscope).

Quel est le protocole suivi ?

– 1/ L’ADN de Mycoplasma mycoides est séquencé (voir les explications);.. puis créé synthétiquement en laboratoire à partir de ces données numériques.

– 2/ La cellule receveuse Mycoplasma capricolum(espèce différente) est privée de son propre ADN.

– 3/ L’ADN de synthèse est introduit dans cette  cellule receveuse.

Cette nouvelle cellule ( Cliquer ici pour voir la photo ) avec  son  seul ADN de synthèse peut se répliquer  et  donne naissance à d’autres cellules identiques….(Cliquer ici pour voir la photo)….

Les nouvelles cellules produites  de «  Mycoplasma mycoides transformées » sont donc uniquement contrôlées par cet ADN  de synthèse.(cliquer ici pour voir les photos)

Une nouvelle espèce est donc créée.


Cependant, il n’existe pour l’instant aucun cadre légal  face à cette possible création de cellules à ADN de synthèse….

Plusieurs groupes de surveillance éthique (canadien et britannique) ont  réagi.

« Cet organisme synthétique, dont l’ETC Group avait déjà annoncé la création et qu’il avait baptisé « Synthia » il y a trois ans, va susciter de vives controverses sur la pertinence, sur le plan éthique, de créer la vie artificiellement et sur les implications de la biologie synthétique, qui constitue un domaine encore pratiquement inconnu. »…….Voir la suite de l’article http://www.etcgroup.org/en/node/5143



Affaire à suivre…..

Tweet about this on TwitterShare on FacebookShare on Google+Share on LinkedInEmail this to someonePrint this page